
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mrpl35
- Ensembl ID:
- ENSDARG00000070589
- ZFIN ID:
- ZDB-GENE-060929-1082
- Description:
- 39S ribosomal protein L35, mitochondrial [Source:RefSeq peptide;Acc:NP_001070193]
- Human Orthologue:
- MRPL35
- Human Description:
- mitochondrial ribosomal protein L35 [Source:HGNC Symbol;Acc:14489]
- Mouse Orthologue:
- Mrpl35
- Mouse Description:
- mitochondrial ribosomal protein L35 Gene [Source:MGI Symbol;Acc:MGI:1913473]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa5634 | Nonsense | F2 line generated | During 2018 |
sa2930 | Nonsense | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa5634
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000103827 | Nonsense | 144 | 175 | 4 | 4 |
ENSDART00000133665 | Nonsense | 157 | 188 | 4 | 4 |
ENSDART00000103827 | Nonsense | 144 | 175 | 4 | 4 |
ENSDART00000133665 | Nonsense | 157 | 188 | 4 | 4 |
- Genomic Location (Zv9):
- Chromosome 17 (position 43557879)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 43522554 GRCz11 17 43513092 - KASP Assay ID:
- 554-3399.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAGGAAGCGTCTGAGGGAACATGTTTTCTGTAAYAAAACTCAGTGTAAAT[T/A]GCTGGACAAAATGACGTCACCCTACTGGAAAAGAAGGAACTGGTACCTCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa2930
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000103827 | Nonsense | 144 | 175 | 4 | 4 |
ENSDART00000133665 | Nonsense | 157 | 188 | 4 | 4 |
ENSDART00000103827 | Nonsense | 144 | 175 | 4 | 4 |
ENSDART00000133665 | Nonsense | 157 | 188 | 4 | 4 |
- Genomic Location (Zv9):
- Chromosome 17 (position 43557879)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 43522554 GRCz11 17 43513092 - KASP Assay ID:
- 554-3399.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAGGAAGCGTCTGAGGGAACATGTTTTCTGTAAYAAAACTCAGTGTAAAT[T/A]GCTGGACAAAATGACGTCACCCTACTGGAAAAGAAGGAACTGGTACCTCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: