zgc:153953

Ensembl ID:
ENSDARG00000070571
ZFIN ID:
ZDB-GENE-061103-190
Description:
hypothetical protein LOC563192 [Source:RefSeq peptide;Acc:NP_001073474]
Human Orthologue:
C1orf106
Human Description:
chromosome 1 open reading frame 106 [Source:HGNC Symbol;Acc:25599]
Mouse Orthologue:
5730559C18Rik
Mouse Description:
RIKEN cDNA 5730559C18 gene Gene [Source:MGI Symbol;Acc:MGI:1921579]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41837 Nonsense Mutation detected in F1 DNA During 2018
sa14459 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41837
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087740 Nonsense 169 612 5 10
ENSDART00000145217 Nonsense 169 226 5 7
Genomic Location (Zv9):
Chromosome 11 (position 25674520)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24503345
GRCz11 11 24740961
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTCAAAGACCTTCAGGAGGCCGTTTTCAGACTGAGACTGGAACACGGA[C/T]GATCCTCACCGCGGCCTGGCATAATCACACAGAGAGGTTAGAGAGTTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14459
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087740 Nonsense 558 612 9 10
ENSDART00000145217   None 226 None 7
Genomic Location (Zv9):
Chromosome 11 (position 25681599)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24510424
GRCz11 11 24748040
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAACTCAAATCATGGCATMAACGCAGCCAATTTCGACCGCCTCGACCA[C/T]AATCGCTGGATCGGAACAGACAAGGAGYGCTCCGTATCCGAAATGTGCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Multiple sclerosis: Genetic risk and a primary role for cell-mediated immune mechanisms in multiple sclerosis. (View Study)
  • Ulcerative colitis: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link