tnrc5

Ensembl ID:
ENSDARG00000070512
ZFIN ID:
ZDB-GENE-050411-12
Description:
Protein canopy homolog 3 [Source:UniProtKB/Swiss-Prot;Acc:A3KNS2]
Human Orthologue:
CNPY3
Human Description:
canopy 3 homolog (zebrafish) [Source:HGNC Symbol;Acc:11968]
Mouse Orthologue:
Cnpy3
Mouse Description:
canopy 3 homolog (zebrafish) Gene [Source:MGI Symbol;Acc:MGI:1919279]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32602 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32602
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040116 Nonsense 32 276 1 6
Genomic Location (Zv9):
Chromosome 1 (position 9649518)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9789304
GRCz11 1 10473415
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGCCAGTAAAACCGGGGATGATGAATGGGTGCATCTGCCAAATAAATG[T/A]GAAGGTAGGCTGTGTTTATTTGTAATGGGTGCACATTTTACCTTAAATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link