zgc:194658

Ensembl ID:
ENSDARG00000070486
ZFIN ID:
ZDB-GENE-081022-138
Description:
retinol binding protein 7, cellular [Source:RefSeq peptide;Acc:NP_001122222]
Human Orthologue:
RBP7
Human Description:
retinol binding protein 7, cellular [Source:HGNC Symbol;Acc:30316]
Mouse Orthologue:
Rbp7
Mouse Description:
retinol binding protein 7, cellular Gene [Source:MGI Symbol;Acc:MGI:1890409]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15840 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15840
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103491 Essential Splice Site 84 135 2 4
Genomic Location (Zv9):
Chromosome 6 (position 45869946)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 45930880
GRCz11 6 45932762
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAAGAGTTTGAGGAAATCACCAAAGGATTGGACAATAGAAAATGCCAG[G/A]TRRAAAACACACATTAGTTGCACAATAAGTGATTTGGCAATAAAAKGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link