zgc:194319

Ensembl ID:
ENSDARG00000070485
ZFIN ID:
ZDB-GENE-080723-52
Description:
centromere protein S [Source:RefSeq peptide;Acc:NP_001122221]
Human Orthologues:
APITD1, APITD1, CORT
Human Descriptions:
apoptosis-inducing, TAF9-like domain 1 [Source:HGNC Symbol;Acc:23163]
apoptosis-inducing, TAF9-like domain 1 [Source:HGNC Symbol;Acc:23163]
cortistatin [Source:HGNC Symbol;Acc:2257]
Mouse Orthologues:
Apitd1, Cort
Mouse Descriptions:
apoptosis-inducing, TAF9-like domain 1 Gene [Source:MGI Symbol;Acc:MGI:1917178]
cortistatin Gene [Source:MGI Symbol;Acc:MGI:109538]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8850 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa8850
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103489 Nonsense 30 127 2 5
Genomic Location (Zv9):
Chromosome 6 (position 45872181)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 45933115
GRCz11 6 45934997
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGTGCATTACACTGTCGGCTCTSTCTGCCAACACATCGCTGAGGACTG[C/A]GAGAAACAAATCACTAAACAGACAATAGCGGCTATAGCGGAGACTGCGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link