zgc:195001

Ensembl ID:
ENSDARG00000070484
ZFIN ID:
ZDB-GENE-081022-173
Description:
hypothetical protein LOC567531 [Source:RefSeq peptide;Acc:NP_001122209]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8844 Essential Splice Site Mutation detected in F1 DNA During 2018
sa18192 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8844
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103487 Essential Splice Site 30 234 2 5
Genomic Location (Zv9):
Chromosome 3 (position 30358067)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30076106
GRCz11 3 30206948
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTWCTCCTACAGGAAGAAAAGGGACAAAAACAGAAGCAAAATCTGCAG[G/A]TATTTGTGAGCTAATTATTTTYAACTGTTAACCACAGCGCCCTCTATTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18192
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103487 Nonsense 231 234 5 5
Genomic Location (Zv9):
Chromosome 3 (position 30355007)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30073046
GRCz11 3 30203888
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTCATGCCTGGTTTCTGGGTGGKCAGAAACTCCTACTGYCAGATCCGA[A/T]AGAAAGATCAGTAGAGGGTGAATATTAGGGATGGGCGGTATCTTAACGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link