zgc:153121

Ensembl ID:
ENSDARG00000070478
ZFIN ID:
ZDB-GENE-060825-13
Description:
Protein AMN1 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q0P4D1]
Human Orthologue:
AMN1
Human Description:
antagonist of mitotic exit network 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:27281]
Mouse Orthologue:
Amn1
Mouse Description:
antagonist of mitotic exit network 1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2442933

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24701 Essential Splice Site Available for shipment Available now
sa3299 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24701
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075151 Essential Splice Site 188 249 5 7
Genomic Location (Zv9):
Chromosome 25 (position 29765900)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28455994
GRCz11 25 28899196
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGGGAGTCATTGGACTTGCAACTGGAGTTTGTTCATGTAGCCTGAAG[G/T]TATTTCATACAGTTTTGTTTCCATTAAAGGTACAGTAGGAGATCTTAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3299
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075151 Essential Splice Site 188 249 5 7
Genomic Location (Zv9):
Chromosome 25 (position 29765901)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28455995
GRCz11 25 28899197
KASP Assay ID:
554-2815.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGGGAGTCATTGGACTTGCAACTGGAGTTTGTTCATGTAGCCTGAAGG[T/A]ATTTCATACAGTTTTGTTTCCATTAAAGGTACAGTAGGAGATYTTAAGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link