zgc:154061

Ensembl ID:
ENSDARG00000070461
ZFIN ID:
ZDB-GENE-060929-922
Description:
Uncharacterized protein C15orf41 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q08BW6]
Human Orthologue:
C15orf41
Human Description:
chromosome 15 open reading frame 41 [Source:HGNC Symbol;Acc:26929]
Mouse Orthologue:
BC052040
Mouse Description:
cDNA sequence BC052040 Gene [Source:MGI Symbol;Acc:MGI:3026886]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25050 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25050
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103434 Essential Splice Site 148 248 7 10
Genomic Location (Zv9):
Chromosome 17 (position 53519710)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 52901309
GRCz11 17 52987553
KASP Assay ID:
554-7335.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGACACTCTGAGAGACAAACTCAGAGAGAGGAACCTGTCGTTTTTAGG[T/G]GAGTCTCCTGCTGCTGCTTCAACACAGGACATTACATCATTTGACCCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link