zgc:153020

Ensembl ID:
ENSDARG00000070460
ZFIN ID:
ZDB-GENE-060929-1198
Description:
G protein-coupled receptor kinase 4 [Source:RefSeq peptide;Acc:NP_001073455]
Human Orthologue:
GRK4
Human Description:
G protein-coupled receptor kinase 4 [Source:HGNC Symbol;Acc:4543]
Mouse Orthologue:
Grk4
Mouse Description:
G protein-coupled receptor kinase 4 Gene [Source:MGI Symbol;Acc:MGI:95801]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39565 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39565
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103412 Nonsense 368 573 12 17
ENSDART00000128330 Nonsense 368 579 12 16
ENSDART00000131205 Nonsense 368 573 12 16
ENSDART00000137724 Nonsense 368 573 12 17

The following transcripts of ENSDARG00000070460 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 11091788)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11231288
GRCz11 1 11918088
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGCACCAGAGGTCATCCAGAACGAGAGCTACACCTTCAGTCCTGACTG[G/A]TGGGGTTTGGGCTGTCTAATTTACGAAATGATTCAGGGTCAGTCTCCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link