zgc:153292

Ensembl ID:
ENSDARG00000070458
ZFIN ID:
ZDB-GENE-060929-1098
Description:
hypothetical protein LOC100003014 [Source:RefSeq peptide;Acc:NP_001070137]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7545 Missense Mutation detected in F1 DNA During 2018
sa33202 Nonsense Mutation detected in F1 DNA During 2018
sa16741 Nonsense Available for shipment Available now
sa15015 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa7545
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103421 Missense 157 415 5 13
ENSDART00000123055 Missense 173 431 5 13

The following transcripts of ENSDARG00000070458 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 31235656)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30953695
GRCz11 3 31084537
KASP Assay ID:
554-4204.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAATGGTTCCAGCCGTGGACTCTTTCAYGCTGGCAGCYTCCAYGAKGAC[T/C]ACTGCAAACCTCAGGTTATTGATTGTTGTTTTATGTTTAGCGGCTTTAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33202
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103421 Nonsense 228 415 8 13
ENSDART00000123055 Nonsense 244 431 8 13

The following transcripts of ENSDARG00000070458 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 31233900)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30951939
GRCz11 3 31082781
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTGAGTATAGATGTAACCGGGCCATTTCAAGAAAGCAAAGGCCCCTA[C/A]AGTCACATCGTGGTCATCTGTGACTATTACACCAAGTGGATTGAAATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16741
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103421 Nonsense 266 415 8 13
ENSDART00000123055 Nonsense 282 431 8 13

The following transcripts of ENSDARG00000070458 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 31233786)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30951825
GRCz11 3 31082667
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCKAATTCTGATTCTGTYGCCCTGCTTATGTGTGATGCCATTTCCCGATA[T/A]GGTTTTCCTCTRGGGTTTCTCACTCCTTGGGGAGCAAGAGGGATTCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15015
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103421 Essential Splice Site 406 415 None 13
ENSDART00000123055 Essential Splice Site 422 431 None 13

The following transcripts of ENSDARG00000070458 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 31232227)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30950266
GRCz11 3 31081108
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAAACCAAATCCTTTAAAAGAAATTGAGGCACTTAAACGAATATTCCG[T/C]GAGTATAACCCTATGCTGTCTGAAGCATTATCAGTGTCTGCTTTTCCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link