
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-194b7.4
- Ensembl ID:
- ENSDARG00000070455
- ZFIN ID:
- ZDB-GENE-100922-188
- Human Orthologue:
- C9orf5
- Human Description:
- chromosome 9 open reading frame 5 [Source:HGNC Symbol;Acc:1363]
- Mouse Orthologue:
- D730040F13Rik
- Mouse Description:
- RIKEN cDNA D730040F13 gene Gene [Source:MGI Symbol;Acc:MGI:2445107]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa22856 | Essential Splice Site | Available for shipment | Available now |
sa17756 | Essential Splice Site | Available for shipment | Available now |
sa36155 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa22856
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000103407 | Essential Splice Site | 174 | 605 | 2 | 13 |
ENSDART00000147438 | None | 432 | None | 11 |
- Genomic Location (Zv9):
- Chromosome 16 (position 29399438)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 27275122 GRCz11 16 27148597 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGACCGATCAAAGGCCTGACACATTTCTTGCTTCGCGTGGACACTAAGG[T/A]AATGCCTTATGTAGACAAACCCACACAAAAGTGCTCGCCTGTCTGCTGAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17756
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000103407 | Essential Splice Site | 300 | 605 | 6 | 13 |
ENSDART00000147438 | Essential Splice Site | 127 | 432 | 4 | 11 |
- Genomic Location (Zv9):
- Chromosome 16 (position 29387269)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 27263043 GRCz11 16 27136485 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AYAAGTTTTGGAGCTGTGGGACCGTCTTTATCAGTCTTGGATTGTGAAGG[T/A]AATTAAAAAANCTCAGCTGCACACAATCCATGTCTTGTAAAAGTTTTTTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36155
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000103407 | Nonsense | 401 | 605 | 9 | 13 |
ENSDART00000147438 | Nonsense | 228 | 432 | 7 | 11 |
- Genomic Location (Zv9):
- Chromosome 16 (position 29385954)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 27261728 GRCz11 16 27135170 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TATAGGTGATTTTCCTGACCACACTTTTTTACCTGCTGAGCTCCAGTGGT[G/T]AATACTATAAACCTGTGAAATGGGTTATCAGCCTCACTCCCCTCTCCCAA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Information processing speed: Whole genome association scan for genetic polymorphisms influencing information processing speed. (View Study)
- Schizophrenia (negative symptoms): BCL9 and C9orf5 are associated with negative symptoms in schizophrenia: meta-analysis of two genome-wide association studies. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: