zgc:162119

Ensembl ID:
ENSDARG00000070454
ZFIN ID:
ZDB-GENE-070410-18
Description:
group XIIA secretory phospholipase A2 [Source:RefSeq peptide;Acc:NP_001076268]
Human Orthologue:
PLA2G12A
Human Description:
phospholipase A2, group XIIA [Source:HGNC Symbol;Acc:18554]
Mouse Orthologue:
Pla2g12a
Mouse Description:
phospholipase A2, group XIIA Gene [Source:MGI Symbol;Acc:MGI:1913600]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32614 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32614
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103406   74 198 1 4
ENSDART00000128845   130 254 1 4
ENSDART00000143628 Essential Splice Site 124 243 None 4
Genomic Location (Zv9):
Chromosome 1 (position 11225758)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11377546
GRCz11 1 12064346
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCTGATCGGAGGCTCAGACGGCCAGTGTCAGTTCACGTGCGGCGACGG[T/A]TCGTCAGACATCAGTAATTCATACAGCTTGCATACAGTACACATTTAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link