zgc:153286

Ensembl ID:
ENSDARG00000070452
ZFIN ID:
ZDB-GENE-060929-208
Description:
transmembrane protein 66 [Source:RefSeq peptide;Acc:NP_001070057]
Human Orthologue:
TMEM66
Human Description:
transmembrane protein 66 [Source:HGNC Symbol;Acc:28789]
Mouse Orthologue:
Tmem66
Mouse Description:
transmembrane protein 66 Gene [Source:MGI Symbol;Acc:MGI:1915137]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16804 Nonsense Available for shipment Available now
sa12717 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16804
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103403 Nonsense 94 345 3 6
ENSDART00000137697 Nonsense 94 346 3 6
Genomic Location (Zv9):
Chromosome 1 (position 11235503)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11367801
GRCz11 1 12054601
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCTCCTTTTTCTCCTCACAGTGGGAATGCAAGGCTGATATGGATAACT[T/A]GTACCGGTTTGGCCGTGTGGAGGTCWCCTGTGAGGGTTATAACAGCCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12717
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103403 Nonsense 257 345 4 6
ENSDART00000137697 Nonsense 258 346 4 6
Genomic Location (Zv9):
Chromosome 1 (position 11233968)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11369336
GRCz11 1 12056136
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGGGTTCTGGGYTCTTTCAGCAGATCACTCCAACTCAAGGCCTGGATA[C/A]GGCTTCTCTGACTCCTACACCAGACCTCAGAGCTCCTGGACTGGTTTYAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link