zdhhc17

Ensembl ID:
ENSDARG00000070441
ZFIN ID:
ZDB-GENE-070424-194
Description:
palmitoyltransferase ZDHHC17 [Source:RefSeq peptide;Acc:NP_001121854]
Human Orthologue:
ZDHHC17
Human Description:
zinc finger, DHHC-type containing 17 [Source:HGNC Symbol;Acc:18412]
Mouse Orthologue:
Zdhhc17
Mouse Description:
zinc finger, DHHC domain containing 17 Gene [Source:MGI Symbol;Acc:MGI:2445110]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa857 Nonsense F2 line generated During 2018
sa33359 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa857
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103371 Nonsense 282 620 8 17
Genomic Location (Zv9):
Chromosome 4 (position 2368548)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2567427
GRCz11 4 2497538
KASP Assay ID:
554-0760.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGGAGGCCAGACAGGCCAAAGGCTACGACAGCCCGTCATATCTGAAA[C/T]GACTCAAGATGGACAAGGTAGAGCATCTGAGCAACTAGASGACGTCAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33359
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103371 Nonsense 441 620 13 17
Genomic Location (Zv9):
Chromosome 4 (position 2375004)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2573883
GRCz11 4 2503994
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACCGATCTGTTCTCTGCAGATACGGAAGCCTATCAGGTCAAAACACTG[C/A]GCCGTGTGCAATCGATGCATCGCCAAGTTTGACCACCACTGTCCGTGGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link