ATP6V1C2

Ensembl ID:
ENSDARG00000070440
Description:
ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2 [Source:HGNC Symbol;Acc:18264]
Human Orthologue:
ATP6V1C2
Human Description:
ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2 [Source:HGNC Symbol;Acc:18264]
Mouse Orthologue:
Atp6v1c2
Mouse Description:
ATPase, H+ transporting, lysosomal V1 subunit C2 Gene [Source:MGI Symbol;Acc:MGI:1916025]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36543 Essential Splice Site Mutation detected in F1 DNA During 2018
sa36542 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36543
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103374 Essential Splice Site 190 380 6 12
Genomic Location (Zv9):
Chromosome 17 (position 52187610)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 51572265
GRCz11 17 51661300
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGTTTTGAACTCAGAGTACCTCACGACACTAATAGTTTTGGTGCCTAG[G/A]TCAGTGTGTGCAGAGCAAATCTTAAGTATCACTTATCTATTTTTTTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36542
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103374 Nonsense 349 380 11 12
Genomic Location (Zv9):
Chromosome 17 (position 52184295)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 51568950
GRCz11 17 51657985
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAACTCTTTATTCAAACACCTCGACCCAGCAGCGATCAGCACCAAACCT[G/T]AGGTAAAAACAACACACAGATCCTTCTCAATGGTCGTGATCTAACAGTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cardiac Troponin-T levels: Association of genome-wide variation with highly sensitive cardiac troponin-T levels in European Americans and Blacks: a meta-analysis from atherosclerosis risk in communities and cardiovascular health studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link