rhov

Ensembl ID:
ENSDARG00000070434
ZFIN ID:
ZDB-GENE-031002-10
Description:
rho-related GTP-binding protein RhoV [Source:RefSeq peptide;Acc:NP_001012250]
Human Orthologue:
RHOV
Human Description:
ras homolog gene family, member V [Source:HGNC Symbol;Acc:18313]
Mouse Orthologue:
Rhov
Mouse Description:
ras homolog gene family, member V Gene [Source:MGI Symbol;Acc:MGI:2444227]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45701 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45701
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103355 Nonsense 219 235 3 3

The following transcripts of ENSDARG00000070434 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 28396595)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 28467898
GRCz11 20 28366988
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATTAAACACAAAGCCAGGAAGGCCAAAAAAAGACGACTGTCGGATAGA[C/T]GAACCAAAGCTTTTTCCAAATGCAGCTGGAAAAAATTCTTCTGCTTCATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link