vps18

Ensembl ID:
ENSDARG00000070433
ZFIN ID:
ZDB-GENE-020419-33
Description:
Vacuolar protein sorting-associated protein 18 homolog [Source:UniProtKB/Swiss-Prot;Acc:P59015]
Human Orthologue:
VPS18
Human Description:
vacuolar protein sorting 18 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:15972]
Mouse Orthologue:
Vps18
Mouse Description:
vacuolar protein sorting 18 (yeast) Gene [Source:MGI Symbol;Acc:MGI:2443626]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10171 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10171
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103352 Nonsense 388 974 4 5
Genomic Location (Zv9):
Chromosome 20 (position 28387558)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 28458861
GRCz11 20 28357951
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGATCCCATAACAGGACTTGTGTGGAWCTACACTGAGAAAGCAGTGTTT[C/T]GATATCACATCCAGAAAGAAGCACGGGACGTTTGGCAGATGTACATGAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link