zgc:153157

Ensembl ID:
ENSDARG00000070423
ZFIN ID:
ZDB-GENE-060825-224
Description:
hypothetical protein LOC751674 [Source:RefSeq peptide;Acc:NP_001038855]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1813 Splice Site F2 line generated During 2018

Mutation Details

Allele Name:
sa1813
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103317   None 252 None 1
ENSDART00000138139 Splice Site None 261 1 1
Genomic Location (Zv9):
Chromosome 20 (position 27763397)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27834700
GRCz11 20 27733790
KASP Assay ID:
554-1805.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTGGGCTGCGACTTGTTAGTGCGCACTAGTGAGACCCGCCTCCCTTCA[T/C]TTTCCATCGGTCCCTTCACCGCAAAACACAGATGTTCTCTATATGTCCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link