zgc:162816

Ensembl ID:
ENSDARG00000070416
ZFIN ID:
ZDB-GENE-070410-94
Description:
LOC571260 protein [Source:UniProtKB/TrEMBL;Acc:Q0P429]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6216 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6216
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124830 Essential Splice Site 177 405 3 9
Genomic Location (Zv9):
Chromosome 11 (position 32436735)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 31348600
GRCz11 11 31611660
KASP Assay ID:
554-4672.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAAAGTCTGGAGCGTCTGGATGAAGCTGGACTGTGAYAACGGAAGAGG[T/C]AAATGATTTACTATATGAACATCTGCTTGTGCTGTCTATTAATAATAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link