
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mtmr7b
- Ensembl ID:
- ENSDARG00000070412
- ZFIN ID:
- ZDB-GENE-050913-66
- Description:
- myotubularin related protein 7b [Source:RefSeq peptide;Acc:NP_001025297]
- Human Orthologue:
- MTMR7
- Human Description:
- myotubularin related protein 7 [Source:HGNC Symbol;Acc:7454]
- Mouse Orthologue:
- Mtmr7
- Mouse Description:
- myotubularin related protein 7 Gene [Source:MGI Symbol;Acc:MGI:1891693]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa2007 | Essential Splice Site | F2 line generated | During 2018 |
sa19458 | Nonsense | Available for shipment | Available now |
sa32635 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa2007
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000127370 | Essential Splice Site | 367 | 568 | 9 | 14 |
- Genomic Location (Zv9):
- Chromosome 1 (position 15237878)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 15803046 GRCz11 1 16495983 - KASP Assay ID:
- 554-3245.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTAGTGTACTACTAGATCCCTACTACAGGACTATCAAGGGATTGATGGTA[G/A]TAACTGATATTTGATTCATGCAAGTGTATATGTCTGTGTGSAACAAACAW
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19458
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000127370 | Nonsense | 385 | 568 | 11 | 14 |
- Genomic Location (Zv9):
- Chromosome 1 (position 15234498)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 15799666 GRCz11 1 16492603 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTTATTCATATTAATATATGAGCTTTATTAAAATCTTCTACATACAGATA[T/A]GCTCATCTTGACGGCGACCCTAAAGAGGTTTCTCCAGTCATGGACCAATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32635
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000127370 | Nonsense | 452 | 568 | 12 | 14 |
- Genomic Location (Zv9):
- Chromosome 1 (position 15230714)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 15795882 GRCz11 1 16488819 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTTATACTTTTATTTGTTTGTTTACTCATTCATTTTGCACTGTGCAGGT[T/A]ACAGGAGAGAACACACTCTCTGTGGCCACATCTGTGGGAGAACAGAGCTG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Creutzfeldt-Jakob disease (variant): Genome-wide study links MTMR7 gene to variant Creutzfeldt-Jakob risk. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: