zgc:158773

Ensembl ID:
ENSDARG00000070401
ZFIN ID:
ZDB-GENE-070424-9
Description:
hypothetical protein LOC793938 [Source:RefSeq peptide;Acc:NP_001075880]
Human Orthologue:
MAL
Human Description:
mal, T-cell differentiation protein [Source:HGNC Symbol;Acc:6817]
Mouse Orthologue:
Mal
Mouse Description:
myelin and lymphocyte protein, T-cell differentiation protein Gene [Source:MGI Symbol;Acc:MGI:892970

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2602 Essential Splice Site F2 line generated During 2018
sa16814 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2602
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103265 Essential Splice Site 130 154 3 4
Genomic Location (Zv9):
Chromosome 11 (position 31504753)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30382115
GRCz11 11 30629299
KASP Assay ID:
554-2942.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCAGATAACATGTTTTTCCTTATTTACCAGCTGGACATTGCTGCTGTGG[T/C]GAGTTTGTGTAGTCTCTTTTTAAATCGGTTTTACCTGTTAAATAAAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16814
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103265 Nonsense 140 154 4 4
Genomic Location (Zv9):
Chromosome 11 (position 31504544)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30381906
GRCz11 11 30629090
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TNNNNGTGTCTTTAATTTCAGGTTTTTTCCTTCCTGACCACTTTACTGTA[T/A]TTCACCCACACCATTTTCTCAGCCTTGCGATGGAAGACCTACTAAAAGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link