alg2

Ensembl ID:
ENSDARG00000070399
ZFIN ID:
ZDB-GENE-060502-2
Description:
alpha-1,3-mannosyltransferase ALG2 [Source:RefSeq peptide;Acc:NP_001098406]
Human Orthologue:
ALG2
Human Description:
asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae) [Source:HGN
Mouse Orthologue:
Alg2
Mouse Description:
asparagine-linked glycosylation 2 homolog (yeast, alpha-1,3-mannosyltransferase) Gene [Source:MGI Sy

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39101 Nonsense Mutation detected in F1 DNA During 2018
sa36156 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39101
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103257 Nonsense 140 455 2 3
ENSDART00000126347 Nonsense 105 243 2 3
Genomic Location (Zv9):
Chromosome 16 (position 29451053)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 27288191
GRCz11 16 27222814
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTCCACGCTCTCTGTGCTTACCTGCGCATGATCTACTTAACTATTTA[T/A]CTCGTGCTCTTTAGTGGAGAGGAGTTTGATGTTGTCTTCTGCGATCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36156
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103257 Nonsense 309 455 3 3
ENSDART00000126347   None 243 None 3
Genomic Location (Zv9):
Chromosome 16 (position 29445180)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 27282318
GRCz11 16 27216941
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTCAGTTGGAGAATGGGAGCGTGTGCACCTTGTAATGGCGGGAGGTTA[C/A]GACGAGCGTGTGGTTGAAAATGTAGAGCACTATGAAGAACTGCGCTCACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link