zgc:194768

Ensembl ID:
ENSDARG00000070394
ZFIN IDs:
ZDB-GENE-081022-148, ZDB-GENE-081022-148
Description:
hypothetical protein LOC556744 [Source:RefSeq peptide;Acc:NP_001128601]
Human Orthologue:
UROC1
Human Description:
urocanase domain containing 1 [Source:HGNC Symbol;Acc:26444]
Mouse Orthologue:
Uroc1
Mouse Description:
urocanase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2385332]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14327 Nonsense Available for shipment Available now
sa38570 Nonsense Mutation detected in F1 DNA During 2018
sa8653 Nonsense Mutation detected in F1 DNA During 2018
sa18516 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14327
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103240 Nonsense 314 675 11 20
ENSDART00000109829 Nonsense 314 675 10 20
Genomic Location (Zv9):
Chromosome 6 (position 39983417)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40055017
GRCz11 6 40052553
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATATTATAGGGAGGCCAAAAAAKCAGGGACGGCGTTGAGCTTAGGCTA[C/A]CATGGAAACATTGTGGATCTCTGGTGGGTTGTGCACWTCATATTCTATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38570
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103240 Nonsense 345 675 12 20
ENSDART00000109829 Nonsense 345 675 11 20
Genomic Location (Zv9):
Chromosome 6 (position 39983256)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40054856
GRCz11 6 40052392
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTAAGAAGACAGGAGAGTTGCTGGTTGATTTGGGTTCTGATCAGACTT[C/A]GCTTCACAATCCGTTCAGTGGAGGATATTACCCAGTGCAGCTTACTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8653
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103240 Nonsense 482 675 15 20
ENSDART00000109829 Nonsense 482 675 14 20
ENSDART00000103240 Nonsense 482 675 15 20
ENSDART00000109829 Nonsense 482 675 14 20
Genomic Location (Zv9):
Chromosome 6 (position 39980060)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40051660
GRCz11 6 40049196
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCAATCGCTACCGCTGTACTAGAAGACATCAGCTCCACAGTTACTGAA[C/T]GAGTYCGAMAGCAATACAGCGACAACATCCGCTGGAWCCGCGAAGCTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18516
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103240 Nonsense 482 675 15 20
ENSDART00000109829 Nonsense 482 675 14 20
ENSDART00000103240 Nonsense 482 675 15 20
ENSDART00000109829 Nonsense 482 675 14 20
Genomic Location (Zv9):
Chromosome 6 (position 39980060)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40051660
GRCz11 6 40049196
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCAATYGCTACCGCTGTACTAGAAGACATCAGCTCCACAGTTACTGAA[C/T]GAGTYCGAMAGCAATACAGCGACAACATCCGCTGGAWCCGCGAAGCTGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link