zgc:163023

Ensembl ID:
ENSDARG00000070391
ZFIN ID:
ZDB-GENE-070410-127
Description:
hypothetical protein LOC556934 [Source:RefSeq peptide;Acc:NP_001076276]
Human Orthologue:
TSPAN4
Human Description:
tetraspanin 4 [Source:HGNC Symbol;Acc:11859]
Mouse Orthologue:
Tspan4
Mouse Description:
tetraspanin 4 Gene [Source:MGI Symbol;Acc:MGI:1928097]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa427 Essential Splice Site Available for shipment Available now
sa40097 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa427
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103239 Essential Splice Site 88 232 4 8
Genomic Location (Zv9):
Chromosome 3 (position 32726609)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32457919
GRCz11 3 32589633
KASP Assay ID:
554-0375.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAACTCCTTTCATTCATGTGTGCTAATAGTAAATTTCTTGTTCTTTCA[G/A]TTTTTTGTGATCCTCTTGATTCTAGTCCTGACAGAAGTTGTGCTGATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40097
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103239 Nonsense 112 232 4 8
Genomic Location (Zv9):
Chromosome 3 (position 32726536)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32457846
GRCz11 3 32589560
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTCCTGACAGAAGTTGTGCTGATTTTGGTTTTGAGTTTATATCACGAA[G/T]AGGTAAGAGACAAGCGTCTAAACCCTGGAAACATTTCAGCCTTTCCTGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link