zgc:154037

Ensembl ID:
ENSDARG00000070371
ZFIN ID:
ZDB-GENE-060929-168
Description:
hypothetical protein LOC767644 [Source:RefSeq peptide;Acc:NP_001070052]
Human Orthologue:
MYST2
Human Description:
MYST histone acetyltransferase 2 [Source:HGNC Symbol;Acc:17016]
Mouse Orthologue:
Myst2
Mouse Description:
MYST histone acetyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:2182799]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18756 Essential Splice Site Mutation detected in F1 DNA During 2018
sa9958 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18756
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083874 Essential Splice Site 52 128 2 3
ENSDART00000103201 Essential Splice Site 52 606 2 15
ENSDART00000134917 Essential Splice Site 52 92 3 4
ENSDART00000144026 Essential Splice Site 52 231 2 7
ENSDART00000145443 Essential Splice Site 52 190 2 4
ENSDART00000148239 Essential Splice Site 52 606 3 16
ENSDART00000083874 Essential Splice Site 52 128 2 3
ENSDART00000103201 Essential Splice Site 52 606 2 15
ENSDART00000134917 Essential Splice Site 52 92 3 4
ENSDART00000144026 Essential Splice Site 52 231 2 7
ENSDART00000145443 Essential Splice Site 52 190 2 4
ENSDART00000148239 Essential Splice Site 52 606 3 16
Genomic Location (Zv9):
Chromosome 3 (position 33037379)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32768689
GRCz11 3 32900403
KASP Assay ID:
2259-3700.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACACTCGCCTCACTCGCTCCTCGTTGAGACTCAGCCGCAGCTCGCAAG[G/A]TAAGACACTGGAAATCACCTTCGTGGAGATCTTGAGTAAAGGTGTGATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9958
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083874 Essential Splice Site 52 128 2 3
ENSDART00000103201 Essential Splice Site 52 606 2 15
ENSDART00000134917 Essential Splice Site 52 92 3 4
ENSDART00000144026 Essential Splice Site 52 231 2 7
ENSDART00000145443 Essential Splice Site 52 190 2 4
ENSDART00000148239 Essential Splice Site 52 606 3 16
ENSDART00000083874 Essential Splice Site 52 128 2 3
ENSDART00000103201 Essential Splice Site 52 606 2 15
ENSDART00000134917 Essential Splice Site 52 92 3 4
ENSDART00000144026 Essential Splice Site 52 231 2 7
ENSDART00000145443 Essential Splice Site 52 190 2 4
ENSDART00000148239 Essential Splice Site 52 606 3 16
Genomic Location (Zv9):
Chromosome 3 (position 33037379)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32768689
GRCz11 3 32900403
KASP Assay ID:
2259-3700.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACACTCGCCTCACTCGCTCCTCRYTGAGACTCAGCCGCAGCTCRCAAG[G/A]TAAGACACTGGAAATCACCTWYGTGGAGATCYTGAGTAAAGGTGTGATTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link