si:dkey-245p14.4

Ensembl ID:
ENSDARG00000070320
ZFIN ID:
ZDB-GENE-061207-63
Description:
hypothetical protein LOC563576 [Source:RefSeq peptide;Acc:NP_001108320]
Mouse Orthologue:
AC127332.1
Mouse Description:
predicted gene 7271 (Gm7271), non-coding RNA [Source:RefSeq DNA;Acc:NR_033501]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24841 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24841
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103089 Nonsense 111 183 3 3
Genomic Location (Zv9):
Chromosome 1 (position 18278740)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18843908
GRCz11 1 19536845
KASP Assay ID:
554-7457.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTAGGATGATCCCTGTTTCTTGATGCATTTCAACTCGGTGCGGCCCATC[A/T]GAGCAGTGAGCTGTGCGGCCAAATACACCCTGGCCCGCTGTCTGCTGTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link