
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
irge4
- Ensembl ID:
- ENSDARG00000070317
- ZFIN ID:
- ZDB-GENE-051212-2
- Description:
- immunity-related GTPase family, e4 [Source:RefSeq peptide;Acc:NP_001076501]
- Mouse Orthologues:
- AC132320.1, Gm4841, Ifi47, Igtp, Iigp1, Irgc1, Tgtp1, Tgtp2
- Mouse Descriptions:
- immunity-related GTPase family, cinema 1 Gene [Source:MGI Symbol;Acc:MGI:2685948]
- interferon gamma induced GTPase Gene [Source:MGI Symbol;Acc:MGI:107729]
- interferon gamma inducible protein 47 Gene [Source:MGI Symbol;Acc:MGI:99448]
- interferon inducible GTPase 1 Gene [Source:MGI Symbol;Acc:MGI:1926259]
- interferon-inducible GTPase-like [Source:RefSeq peptide;Acc:NP_001094945]
- predicted gene 4841 Gene [Source:MGI Symbol;Acc:MGI:3643814]
- T-cell specific GTPase 1 Gene [Source:MGI Symbol;Acc:MGI:98734]
- T-cell specific GTPase 2 Gene [Source:MGI Symbol;Acc:MGI:3710083]
Alleles
There are 6 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa28662 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa194 | Nonsense | Confirmed mutation in F2 line | During 2018 |
sa28661 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa23 | Nonsense | Confirmed mutation in F2 line | During 2018 |
sa18438 | Nonsense | Available for shipment | Available now |
sa24 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa28662
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000086301 | None | 385 | None | 3 | |
ENSDART00000086303 | Nonsense | 27 | 713 | 1 | 7 |
- Genomic Location (Zv9):
- Chromosome 16 (position 28067360)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 25913047 GRCz11 16 25828079 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCAGGACCCTGCTATTGCTGAGGCAGTGCAGGCCTCTGGTGAATCAACCT[T/A]GGAAAAGGCCACAGCAAAAGCCAAAGAAAGTTTTGACCAGTTTATGAATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa194
- Current Status:
-
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000086301 | None | 385 | None | 3 | |
ENSDART00000086303 | Nonsense | 122 | 713 | 1 | 7 |
- Genomic Location (Zv9):
- Chromosome 16 (position 28067075)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 25912762 GRCz11 16 25827794 - KASP Assay ID:
- 554-0107.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AATAGGAAGTCCAAACTTCAAAGCAGATAAATACCTTAAAGATGTCAAAT[T/A]AAAAAATTATGACTTCTTCATTATTTTGAACTCCGAGAGGTTCATGCAGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa28661
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000086301 | None | 385 | None | 3 | |
ENSDART00000086303 | Nonsense | 229 | 713 | 2 | 7 |
- Genomic Location (Zv9):
- Chromosome 16 (position 28066743)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 25912430 GRCz11 16 25827462 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAAACACACTAGCAGAAGAGCTTCCAGTCCATAAGAGAAATGCTCTCCTA[C/T]AAGCCTGGCCGGTGTGCTCTGCTGCATCTTTGGAGATGAAGATCAAGATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23
- Current Status:
-
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000086301 | None | 385 | None | 3 | |
ENSDART00000086303 | Nonsense | 231 | 713 | 2 | 7 |
- Genomic Location (Zv9):
- Chromosome 16 (position 28066736)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 25912423 GRCz11 16 25827455 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTAGCAGAAGAGCTTCCAGTCCATAAGAGAAATGCTCTCCTACAAGCCT[G/A]GCCGGTGTGCTCTGCTGCATCTTTGGAGATGAAGATCAAGATGTTTGAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18438
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000086301 | None | 385 | None | 3 | |
ENSDART00000086303 | Nonsense | 333 | 713 | 3 | 7 |
- Genomic Location (Zv9):
- Chromosome 16 (position 28066236)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 25911923 GRCz11 16 25826955 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAAAAGAGGTGCTGGACAGTGTTCGATAGCTCRTAGATGTCCGGTAATTG[T/A]ATTTTTGGAAAAAAGTGTTGTTTTTTTKATTGCTTTAATTGGTTGTTTAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000086301 | Nonsense | 168 | 385 | 3 | 3 |
ENSDART00000086303 | Nonsense | 567 | 713 | 7 | 7 |
- Genomic Location (Zv9):
- Chromosome 16 (position 28062958)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 25908645 GRCz11 16 25823677 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATTTTGTTCGAAACAAGATTGATAATGACATTTGCTCAGTAGCGAATGGA[A/T]AAATCAACGAGCAGCAGCTGCTTTGCGCAATCAGGGAAGACTGCTACAGA
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: