zgc:171553

Ensembl ID:
ENSDARG00000070314
ZFIN ID:
ZDB-GENE-030131-1629
Description:
hypothetical protein LOC322909 [Source:RefSeq peptide;Acc:NP_001108355]
Human Orthologues:
AC026150.5, AC091304.2, AC100756.2, AC135983.4, AC138749.1, CALD1, GOLGA6L1, GOLGA6L2, GOLGA6L6
Human Descriptions:
caldesmon 1 [Source:HGNC Symbol;Acc:1441]
golgin A6 family-like 1 [Source:HGNC Symbol;Acc:37444]
golgin A6 family-like 2 [Source:HGNC Symbol;Acc:26695]
golgin A6 family-like 6 [Source:HGNC Symbol;Acc:37225]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9IYW0]
Mouse Orthologue:
Cald1
Mouse Description:
caldesmon 1 Gene [Source:MGI Symbol;Acc:MGI:88250]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16974 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16974
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103048 Nonsense 190 518 3 13
Genomic Location (Zv9):
Chromosome 4 (position 6541485)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 7463444
GRCz11 4 7472014
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GRAGAAGAGGAGGAGGAGCAGCGAGTGGAGGAGAAGCAACAAAGGTCTTA[T/A]TTAAGMGAACGGGTGAGYACTTATTTMATTTTTTGAYGGTTCAAAGGGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link