spock3

Ensembl ID:
ENSDARG00000070266
ZFIN ID:
ZDB-GENE-090311-24
Description:
Im:7139568 protein [Source:UniProtKB/TrEMBL;Acc:A8KB02]
Human Orthologue:
SPOCK3
Human Description:
sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3 [Source:HGNC Symbol;Acc:135
Mouse Orthologue:
Spock3
Mouse Description:
sparc/osteonectin, cwcv and kazal-like domains proteoglycan 3 Gene [Source:MGI Symbol;Acc:MGI:192015

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39600 Nonsense Mutation detected in F1 DNA During 2018
sa11967 Essential Splice Site Available for shipment Available now
sa17392 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa39600
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078295 Nonsense 86 393 6 13
ENSDART00000102969 Nonsense 105 412 4 11
ENSDART00000139461 Nonsense 82 308 4 10
ENSDART00000145418 Nonsense 95 253 5 9
Genomic Location (Zv9):
Chromosome 1 (position 19455136)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 19980895
GRCz11 1 20673832
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTGAAGATAAAATGTGGCCGTCATAAAGTGTGTGTAGCTGAAGATTA[C/A]CAAACACCCACCTGTGTCAGTCAGCGCAGGATGAGGTAAGCTGACTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11967
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078295 Essential Splice Site 98 393 6 13
ENSDART00000102969 Essential Splice Site 117 412 4 11
ENSDART00000139461 Essential Splice Site 94 308 4 10
ENSDART00000145418 Essential Splice Site 107 253 5 9
Genomic Location (Zv9):
Chromosome 1 (position 19455172)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 19980931
GRCz11 1 20673868
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTRGCTGAAGATTACCAAACACCCACCTGTGTCAGTCAGCGCAGGATGAG[G/A]TAAGCTGACTCACAGTACCTGNNTATTAMTGAAWTTATAGTAAAAACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17392
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078295 Essential Splice Site 300 393 11 13
ENSDART00000102969 Essential Splice Site 319 412 9 11
ENSDART00000139461 Essential Splice Site 296 308 9 10
ENSDART00000145418   None 253 None 9
Genomic Location (Zv9):
Chromosome 1 (position 19479349)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 20005108
GRCz11 1 20698045
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGAGATCACCATYATCCACAAACAGCAGGCTGGCAAGAAGCTACTGGG[T/C]GAGTCTAGTGTCTTGTGTATTTACAWATGGACTTTTCTGGTACATGTTTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link