suz12a

Ensembl ID:
ENSDARG00000070256
ZFIN ID:
ZDB-GENE-040801-36
Description:
Polycomb protein suz12-A [Source:UniProtKB/Swiss-Prot;Acc:Q6DC03]
Human Orthologue:
SUZ12
Human Description:
suppressor of zeste 12 homolog (Drosophila) [Source:HGNC Symbol;Acc:17101]
Mouse Orthologue:
Suz12
Mouse Description:
suppressor of zeste 12 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1261758]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20077 Essential Splice Site Available for shipment Available now
sa1522 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa20077
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102952 Essential Splice Site 164 657 7 16

The following transcripts of ENSDARG00000070256 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 35944444)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35729640
GRCz11 3 35859148
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATATTTTAAAAGCCTCTGTAAAAATGTGCTAATTTTCATTCTGTTTTA[G/A]GATGTGACTTGTCCAGTGAAGCAAGTGCCTACGGGTAAAAAGCAGGTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1522
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102952 Nonsense 388 657 11 16

The following transcripts of ENSDARG00000070256 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 35943119)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35728315
GRCz11 3 35857823
KASP Assay ID:
554-1446.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGGCACTGATCTACCAGTTAGAAGAGAACAAACTCACATTGAACCTTG[T/A]CAGAAACTACATGTTTATTATCAGGTGAGTAATAAGCATCTATAAATTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link