si:dkey-9k8.1

Ensembl ID:
ENSDARG00000070239
ZFIN ID:
ZDB-GENE-030131-5437
Description:
Novel protein (Wu:fd18f09) [Source:UniProtKB/TrEMBL;Acc:B8A4V0]
Human Orthologue:
CASC5
Human Description:
cancer susceptibility candidate 5 [Source:HGNC Symbol;Acc:24054]
Mouse Orthologue:
Casc5
Mouse Description:
cancer susceptibility candidate 5 Gene [Source:MGI Symbol;Acc:MGI:1923714]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17976 Nonsense Available for shipment Available now
sa19442 Nonsense Available for shipment Available now
sa32611 Nonsense Mutation detected in F1 DNA During 2018
sa12744 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17976
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102929 Nonsense 1195 1824 9 25
ENSDART00000147648 Nonsense 1165 1794 7 23
Genomic Location (Zv9):
Chromosome 1 (position 10284055)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10416393
GRCz11 1 11100504
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CMTTTTCCTCAAGGATGTCAYTGTGTGGGGYTRTTCCAAAGCTACCAAAA[C/T]GARCTACAGCTTTCACTCCCAACAAATCCCTGCCCATAAGTWTAAATGRT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19442
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102929 Nonsense 1303 1824 9 25
ENSDART00000147648 Nonsense 1273 1794 7 23
Genomic Location (Zv9):
Chromosome 1 (position 10283731)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10416069
GRCz11 1 11100180
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCTTCTTTTAAAAGGCCACATCCAGAGGAAGAACCTATTACACCAGAA[C/T]AAACCAAGAAGACCTGTGTTTCTGACATGGTAGGCACAAATGTTAATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32611
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102929 Nonsense 1447 1824 14 25
ENSDART00000147648 Nonsense 1417 1794 12 23
Genomic Location (Zv9):
Chromosome 1 (position 10280775)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10413113
GRCz11 1 11097224
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAATATGTAATATATTTTATGGAACCTATTTTCTCATAGACTTAAAGAA[C/T]AAATGTCTGCACAAGAGAAATCCCTGAGAAGCATCAATGGAGCCCTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12744
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102929 Essential Splice Site 1570 1824 17 25
ENSDART00000147648 Essential Splice Site 1540 1794 15 23
Genomic Location (Zv9):
Chromosome 1 (position 10277801)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10410139
GRCz11 1 11094250
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTCTTGATCTWCCTCAAGCAGGACCAGCCTTAAAAGCCAAGGAAGAAGG[T/C]AAGTTAAGTTMTATATAACCGATTTTTATGAAGCTATTAAGGAWAATGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link