
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
NP_001136427.1
- Ensembl ID:
- ENSDARG00000070217
- Description:
- hypothetical protein LOC751699 [Source:RefSeq peptide;Acc:NP_001136427]
- Human Orthologue:
- C1orf151
- Human Description:
- chromosome 1 open reading frame 151 [Source:HGNC Symbol;Acc:32068]
- Mouse Orthologue:
- 2310028O11Rik
- Mouse Description:
- RIKEN cDNA 2310028O11 gene Gene [Source:MGI Symbol;Acc:MGI:1913628]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa14048 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa14048
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000125739 | Essential Splice Site | 38 | 76 | None | 4 |
ENSDART00000132266 | None | 76 | None | 4 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 23 (position 40046827)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 39857680 GRCz11 23 39750591 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGTACKGGTCTGGGTCTAGGAATTGTGTTCTCTGTTGTATTCTTCAAGCG[T/G]AAGTGTACTACATAGTGCATGCCGAGTGAAGCTACTGTAGAGCTGCATGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: