slc41a1

Ensembl ID:
ENSDARG00000070214
ZFIN ID:
ZDB-GENE-030131-4700
Human Orthologue:
SLC41A1
Human Description:
solute carrier family 41, member 1 [Source:HGNC Symbol;Acc:19429]
Mouse Orthologue:
Slc41a1
Mouse Description:
solute carrier family 41, member 1 Gene [Source:MGI Symbol;Acc:MGI:2444823]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44746 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44746
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102870 Essential Splice Site 483 544 9 10
Genomic Location (Zv9):
Chromosome 11 (position 39117977)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 37684996
GRCz11 11 37952201
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCACTTACATCTTCATTGCTTTTTACCTGGCTGCTGCTCTACTACAGG[T/C]ACACCTGAACATCTGCTTATTATTACAAGGAAATAATCTGGGCTTCAAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Parkinson's disease: Genome-wide association study identifies common variants at four loci as genetic risk factors for Parkinson's disease. (View Study)
  • Parkinson's disease: Web-based genome-wide association study identifies two novel loci and a substantial genetic component for Parkinson's disease. (View Study)
  • Prostate-specific antigen levels: Genome-wide association study identified novel genetic variant on SLC45A3 gene associated with serum levels prostate-specific antigen (PSA) in a Chinese population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link