Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-225p5.3
- Ensembl ID:
- ENSDARG00000070178
- ZFIN ID:
- ZDB-GENE-030131-5363
- Description:
- si:ch211-225p5.3 [Source:RefSeq peptide;Acc:NP_001156319]
- Human Orthologues:
- POMZP3, ZP3
- Human Descriptions:
- POM121 and ZP3 fusion [Source:HGNC Symbol;Acc:9203]
- zona pellucida glycoprotein 3 (sperm receptor) [Source:HGNC Symbol;Acc:13189]
- Mouse Orthologue:
- Zp3
- Mouse Description:
- zona pellucida glycoprotein 3 Gene [Source:MGI Symbol;Acc:MGI:99215]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa2852 | Nonsense | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa2852
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000102798 | Nonsense | 2 | 474 | 1 | 8 |
- Genomic Location (Zv9):
- Chromosome 16 (position 44825540)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 42106048 GRCz11 16 42056080 - KASP Assay ID:
- 554-2911.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- WTGGAAAACGTATYAAGGTTGCCAASACTGGTTGAGTGAATTCCTTGATG[C/T]GATTCAAAGATATGAAGCTTCATTTCCTCTTAATAATACTTTTATTTGTC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
