
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000070174
- Ensembl ID:
- ENSDARG00000070174
- Human Orthologue:
- MYO15B
- Human Description:
- myosin XVB pseudogene [Source:HGNC Symbol;Acc:14083]
- Mouse Orthologues:
- Myo15b, Myo3b
- Mouse Descriptions:
- myosin IIIB Gene [Source:MGI Symbol;Acc:MGI:2448580]
- myosin XVB Gene [Source:MGI Symbol;Acc:MGI:2685534]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12019 | Nonsense | Available for shipment | Available now |
sa40118 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa26121 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa12795 | Nonsense | Available for shipment | Available now |
sa33251 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa12019
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000102784 | Nonsense | 295 | 634 | 6 | 10 |
- Genomic Location (Zv9):
- Chromosome 3 (position 37032841)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 36896201 GRCz11 3 37038059 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CAGAAGTGGAGAGCTAYGCGTCCTTCATTGGCCAGGCTCTAGAGAAGACC[C/T]GAGGCAGAGAGTGTGTGCCCTCGTGGGAGGAGATTCAAGGGCTGATGGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40118
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000102784 | Essential Splice Site | 339 | 634 | 6 | 10 |
- Genomic Location (Zv9):
- Chromosome 3 (position 37032976)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 36896336 GRCz11 3 37038194 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GACCAGGCTGCTGCCAGATACCCATCACCTCACACACCACAGCTAATGAG[G/A]TTCGGTTTCAATCCTTTCCTACAACTCTGACTCACTAAAAAGTTATTTAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa26121
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000102784 | Nonsense | 362 | 634 | 7 | 10 |
- Genomic Location (Zv9):
- Chromosome 3 (position 37034639)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 36897999 GRCz11 3 37039857 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGGAGCGCCTCGGGCTGCAGGACAGCCGAAACACGTTTGGTCTTTTTGAG[C/T]AGAATGCATGCTGGGAAAAAGCTATAGGAGGCAGCACAATAATCGCTGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12795
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000102784 | Nonsense | 452 | 634 | 9 | 10 |
- Genomic Location (Zv9):
- Chromosome 3 (position 37038969)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 36902329 GRCz11 3 37044187 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCAGCTTGTGAGGAAGATCTTCTTTCACTGGCGGCGCTGAGGCTGCAGTA[T/G]CTGCTGGGGGATTTCAGCGCCCTYTCTCCGTACCCGGCGCTAGAGCAGCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33251
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000102784 | Nonsense | 591 | 634 | 10 | 10 |
- Genomic Location (Zv9):
- Chromosome 3 (position 37040834)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 36904194 GRCz11 3 37046052 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCTCTCAGAAGTTGTGGCTGGGTGTAGCGGCATCCTGCGTGACTCTGTA[T/A]CGTCAGGGCGAGGCTGAAGCGCTGGAGTCTCTGCCCATCACTCAGATCTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: