
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
gria2a
- Ensembl ID:
- ENSDARG00000070173
- ZFIN ID:
- ZDB-GENE-020125-3
- Description:
- glutamate receptor, ionotropic, AMPA 2a [Source:RefSeq peptide;Acc:NP_571969]
- Human Orthologue:
- GRIA2
- Human Description:
- glutamate receptor, ionotropic, AMPA 2 [Source:HGNC Symbol;Acc:4572]
- Mouse Orthologue:
- Gria2
- Mouse Description:
- glutamate receptor, ionotropic, AMPA2 (alpha 2) Gene [Source:MGI Symbol;Acc:MGI:95809]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12891 | Nonsense | Available for shipment | Available now |
sa8383 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa12891
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000077805 | None | 250 | None | 5 | |
ENSDART00000102782 | Nonsense | 768 | 875 | 14 | 16 |
ENSDART00000138791 | Nonsense | 697 | 804 | 12 | 14 |
- Genomic Location (Zv9):
- Chromosome 1 (position 20120583)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 20645000 GRCz11 1 21337937 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTATCGTTTGTTTAAGAAACGCGGTAAACCTTGCAGTGCTAAAACTGAAY[G/T]AGCAGGGGCTTCTGGWTAAATTGAAAAACAAATGGTGGTAMGACAAAGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa8383
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000077805 | None | 250 | None | 5 | |
ENSDART00000102782 | Nonsense | 781 | 875 | 14 | 16 |
ENSDART00000138791 | Nonsense | 710 | 804 | 12 | 14 |
- Genomic Location (Zv9):
- Chromosome 1 (position 20120542)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 20644959 GRCz11 1 21337896 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAACTGAAYGAGCAGGGGCTTCTGGWTAAATTGAAAAACAAATGGTGGTA[C/A]GACAAAGGAGAGTGCGGCAGCGGAGGCGGGGAGTCAAAGGTCAGACCCGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: