slc25a13

Ensembl ID:
ENSDARG00000070172
ZFIN ID:
ZDB-GENE-080319-2
Description:
Novel protein similar to vertebrate solute carrier family 25, member 13 (Citrin) (SLC25A13) [Source:
Human Orthologue:
SLC25A13
Human Description:
solute carrier family 25, member 13 (citrin) [Source:HGNC Symbol;Acc:10983]
Mouse Orthologue:
Slc25a13
Mouse Description:
solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 13 Gene [S

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43336 Nonsense Mutation detected in F1 DNA During 2018
sa36899 Nonsense Mutation detected in F1 DNA During 2018
sa43335 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43336
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102780 Nonsense 201 667 5 20
ENSDART00000141163   None 103 None 3

The following transcripts of ENSDARG00000070172 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 42312031)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41755354
GRCz11 19 41340409
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGACATCATGGTGACCATCAGACCTCACATGCTCACTCGGTTTGTGGAG[G/T]AAAGTCTTGTCGCAGTGAGTTTTTCAGTCAGTGTTTTTACTGTATTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36899
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102780 Nonsense 307 667 8 20
ENSDART00000141163   None 103 None 3

The following transcripts of ENSDARG00000070172 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 42295060)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGAGATGATTGCACCTCTGGAGGAGGGAGCGCTTCCTTACAACCTTGCT[G/T]AGATTCAAAGACAGGTATGTTTCAGATATAGACCTGGGAAAATGGATGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43335
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102780 Nonsense 371 667 10 20
ENSDART00000141163   None 103 None 3

The following transcripts of ENSDARG00000070172 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 42284893)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41736836
GRCz11 19 41321891
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCATGCAGAACCAGCGCTCTTCAGGGTCCTTAGTGGAAGAGCTCATGTA[C/A]AAGAACAGCCTGGACTGCTTTAAGAAGGTCGTGCGCTACGAGGGCTTCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link