zgc:162129

Ensembl ID:
ENSDARG00000070171
ZFIN IDs:
ZDB-GENE-030131-6256, ZDB-GENE-030131-6256
Description:
ERBB receptor feedback inhibitor 1 [Source:RefSeq peptide;Acc:NP_001077039]
Human Orthologue:
ERRFI1
Human Description:
ERBB receptor feedback inhibitor 1 [Source:HGNC Symbol;Acc:18185]
Mouse Orthologue:
Errfi1
Mouse Description:
ERBB receptor feedback inhibitor 1 Gene [Source:MGI Symbol;Acc:MGI:1921405]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41907 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41907
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102779 Nonsense 24 447 2 4
ENSDART00000130749 Nonsense 24 447 1 3
Genomic Location (Zv9):
Chromosome 11 (position 42316616)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 40576022
GRCz11 11 40840167
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGCATGTCCACTGCAGGCTTGACTGCCCAGGAGATCTGTTTACCCACG[C/T]AAAGCCTTTTCCTGCGGGGCAGCCACTGGCATAGCATGGCCGGAGCTAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link