zgc:165473

Ensembl ID:
ENSDARG00000070168
ZFIN ID:
ZDB-GENE-050309-208
Description:
superoxide dismutase-like [Source:RefSeq peptide;Acc:NP_001092706]
Human Orthologue:
SOD3
Human Description:
superoxide dismutase 3, extracellular [Source:HGNC Symbol;Acc:11181]
Mouse Orthologue:
Sod3
Mouse Description:
superoxide dismutase 3, extracellular Gene [Source:MGI Symbol;Acc:MGI:103181]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38656 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38656
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102756 Essential Splice Site None 213 1 2
Genomic Location (Zv9):
Chromosome 7 (position 73892778)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 71096865
GRCz11 7 71335920
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGACTGAATTATTCAGCCTGTTTCAGGACAACATTTCAGCTATAAGG[T/C]AATGTACCTTCGCTGCTTTTGACATGTTTGGATATTTCTGTATGGTGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Major depressive disorder: Common genetic variation and antidepressant efficacy in major depressive disorder: a meta-analysis of three genome-wide pharmacogenetic studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link