vamp3

Ensembl ID:
ENSDARG00000070161
ZFIN ID:
ZDB-GENE-040625-45
Description:
vesicle-associated membrane protein 3 (cellubrevin) [Source:RefSeq peptide;Acc:NP_001002073]
Human Orthologue:
VAMP3
Human Description:
vesicle-associated membrane protein 3 (cellubrevin) [Source:HGNC Symbol;Acc:12644]
Mouse Orthologue:
Vamp3
Mouse Description:
vesicle-associated membrane protein 3 Gene [Source:MGI Symbol;Acc:MGI:1321389]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30662 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30662
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102734 Essential Splice Site None 102 5 6
ENSDART00000137516   None 102 5 5

The following transcripts of ENSDARG00000070161 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 41430266)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 39689947
GRCz11 11 39954092
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAAACAACAGGTTGCCATCATAATATATCGACCAAAACCCATCTAAAC[T/G]CTTGTTTTGAAAGCCATCTGAGTTCCTCGTGGACTGTATTTTATCAGACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link