zgc:154169

Ensembl ID:
ENSDARG00000070140
ZFIN ID:
ZDB-GENE-061110-141
Description:
all-trans-13,14-dihydroretinol saturase [Source:RefSeq peptide;Acc:NP_001071261]
Human Orthologue:
RETSAT
Human Description:
retinol saturase (all-trans-retinol 13,14-reductase) [Source:HGNC Symbol;Acc:25991]
Mouse Orthologue:
Retsat
Mouse Description:
retinol saturase (all trans retinol 13,14 reductase) Gene [Source:MGI Symbol;Acc:MGI:1914692]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40126 Essential Splice Site Mutation detected in F1 DNA During 2018
sa33258 Nonsense Available for shipment Available now
sa31348 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40126
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102690 Essential Splice Site 328 607 5 11
Genomic Location (Zv9):
Chromosome 3 (position 39190347)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39053707
GRCz11 3 39195565
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCACCTGTAAACCGCATTCTCCTCAATGATGCTAAAGAGGCTATTGG[T/C]AAAACGTTCCACTTTCTATAAAGATATACTGTATCCTCTTACTACACTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33258
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102690 Nonsense 355 607 6 11
Genomic Location (Zv9):
Chromosome 3 (position 39190129)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39053489
GRCz11 3 39195347
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGTACGAGCCCCCATTGTGATTTCAGATGCTGGAATCTTTAATACCTA[T/A]GAACATCTCCTGCCCAAAGATGTGCAGACTATGCCTGGTGAGAGAGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31348
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102690 Nonsense 443 607 8 11
Genomic Location (Zv9):
Chromosome 3 (position 39189641)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39053001
GRCz11 3 39194859
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTAAAAAGTTGCCTGTAATTTTTGTGGCCTCACCTTCTGCCAAAGACT[C/A]AACCTGGCCAGAAAGGGAACCAGGTAAAGAGAAAAATGAAAAACACTTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link