zgc:136346

Ensembl ID:
ENSDARG00000070108
ZFIN ID:
ZDB-GENE-060512-191
Description:
protein DEK [Source:RefSeq peptide;Acc:NP_001038741]
Human Orthologue:
DEK
Human Description:
DEK oncogene [Source:HGNC Symbol;Acc:2768]
Mouse Orthologue:
Dek
Mouse Description:
DEK oncogene (DNA binding) Gene [Source:MGI Symbol;Acc:MGI:1926209]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22921 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22921
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058586 Nonsense 416 443 9 11
ENSDART00000102594   None 389 10 12
ENSDART00000124543   None 104 None 3
Genomic Location (Zv9):
Chromosome 16 (position 43694187)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 41078580
GRCz11 16 41028612
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTCCTGAAAGACGCAAACCTGGAGGAGGTTACAATGAAGCAGATAACC[C/T]GACAAGTATGTTATTTCACCTTTATTGGGACAGAAGCTTACTTTAAAGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link