si:dkey-228a15.3

Ensembl ID:
ENSDARG00000070094
ZFIN ID:
ZDB-GENE-060503-439
Description:
synaptotagmin-like [Source:RefSeq peptide;Acc:NP_001122005]
Human Orthologue:
SYTL1
Human Description:
synaptotagmin-like 1 [Source:HGNC Symbol;Acc:15584]
Mouse Orthologue:
Sytl1
Mouse Description:
synaptotagmin-like 1 Gene [Source:MGI Symbol;Acc:MGI:1933365]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa393 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa393
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102583 Nonsense 137 539 4 15
Genomic Location (Zv9):
Chromosome 19 (position 44186470)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43014238
GRCz11 19 42583675
KASP Assay ID:
554-0255.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATGAATGAAAGAGAGGACGATAAGCATCAGGAACAGAAGGAAAGCGGA[C/T]AAGAAGATGGGGAAAGGTTGGTGCAATTTTTGTTTGTAATCTTTATTGCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link