zgc:163069

Ensembl ID:
ENSDARG00000070083
ZFIN ID:
ZDB-GENE-070424-51
Description:
ATP synthase subunit beta [Source:UniProtKB/TrEMBL;Acc:Q05AL6]
Human Orthologue:
ATP5B
Human Description:
ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide [Source:HGNC Symbol;Acc:83
Mouse Orthologue:
Atp5b
Mouse Description:
ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35047 Essential Splice Site Mutation detected in F1 DNA During 2018
sa21867 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35047
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060310 Essential Splice Site 318 529 7 11
Genomic Location (Zv9):
Chromosome 11 (position 13396513)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 13153336
GRCz11 11 13210995
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCTCTTTATTGACAACATTTTCCGCTTCACCCAGGCTGGATCAGAGG[T/C]CAGTAAACGATTCATAAGTCAAATATAAAAAAGTAAATCAATAAATAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21867
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060310 Nonsense 332 529 8 11
Genomic Location (Zv9):
Chromosome 11 (position 13396648)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 13153471
GRCz11 11 13211130
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGATTAGGTGTCTGCCCTTCTGGGTCGTATCCCCTCTGCTGTGGGTTA[T/A]CAGCCAACTCTGGCCACTGACATGGGTACCATGCAGGAAAGAATCACAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link