
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:162040
- Ensembl ID:
- ENSDARG00000070081
- ZFIN ID:
- ZDB-GENE-030131-9814
- Description:
- R-spondin-3 [Source:UniProtKB/Swiss-Prot;Acc:Q5R328]
- Human Orthologue:
- RSPO3
- Human Description:
- R-spondin 3 homolog (Xenopus laevis) [Source:HGNC Symbol;Acc:20866]
- Mouse Orthologue:
- Rspo3
- Mouse Description:
- R-spondin 3 homolog (Xenopus laevis) Gene [Source:MGI Symbol;Acc:MGI:1920030]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa14295 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa14295
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000058578 | Nonsense | 297 | 317 | 6 | 6 |
The following transcripts of ENSDARG00000070081 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 16 (position 43004839)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 40388289 GRCz11 16 40338321 - KASP Assay ID:
- 2261-0147.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAGAGAGGAAGAGGGAACGAGAGAAGGAGACAATCGACCGAGAGGAATCC[G/T]AAARCAGGAAYAAAACAGARCAGCGCCGYCGCAGGGACCAGAGCAGAGAC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Bone mineral density: Genome-wide association study using extreme truncate selection identifies novel genes affecting bone mineral density and fracture risk. (View Study)
- Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)
- Intracranial volume: Common variants at 6q22 and 17q21 are associated with intracranial volume. (View Study)
- Iron status biomarkers: Variants in TF and HFE explain approximately 40% of genetic variation in serum-transferrin levels. (View Study)
- Renal function-related traits (urea): Meta-analysis identifies multiple loci associated with kidney function-related traits in east Asian populations. (View Study)
- Triglycerides: Large-scale genome-wide association studies in East Asians identify new genetic loci influencing metabolic traits. (View Study)
- Waist-hip ratio: Meta-analysis identifies 13 new loci associated with waist-hip ratio and reveals sexual dimorphism in the genetic basis of fat distribution. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: