
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
actr2b
- Ensembl ID:
- ENSDARG00000070076
- ZFIN ID:
- ZDB-GENE-050410-4
- Description:
- Actin-related protein 2-B [Source:UniProtKB/Swiss-Prot;Acc:Q56A35]
- Human Orthologue:
- ACTR2
- Human Description:
- ARP2 actin-related protein 2 homolog (yeast) [Source:HGNC Symbol;Acc:169]
- Mouse Orthologue:
- Actr2
- Mouse Description:
- ARP2 actin-related protein 2 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1913963]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa13493 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa13493
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000102555 | Nonsense | 222 | 394 | 6 | 10 |
ENSDART00000144931 | Nonsense | 73 | 245 | 2 | 5 |
- Genomic Location (Zv9):
- Chromosome 13 (position 5640410)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 5834868 GRCz11 13 5963345 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CATTCAGCAGACTTCGAGACGGTGCGCATGATGAAGGAGAATCTCTGCTA[T/A]GTGGGATACAACATCGAGCAGGAGCAGAAGCTCGCTCTGGAGACCACSGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: