
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000070073
- Ensembl ID:
- ENSDARG00000070073
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa21869 | Nonsense | Available for shipment | Available now |
sa1494 | Nonsense | Available for shipment | Available now |
sa31821 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa21869
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000102548 | Nonsense | 82 | 414 | 2 | 9 |
- Genomic Location (Zv9):
- Chromosome 11 (position 13692930)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 13449753 GRCz11 11 13507412 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACCACTCACGCAGATTTTAAGCCCATGCCCATGTCCGCAGCCCAACTATG[T/A]CGACCCACCACCACAGGCTGGATAAATTTGCTGGAAGTTAAAAGTCCAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1494
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000102548 | Nonsense | 164 | 414 | 4 | 9 |
- Genomic Location (Zv9):
- Chromosome 11 (position 13695349)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 13452172 GRCz11 11 13509831 - KASP Assay ID:
- 554-1419.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AATTCAATGACATGTTTGCNTTTTATTTCATTGCATCTTTTATTTAGCAA[C/T]GAATTCAGTATTCATCTGTTGCAATGGGAGACCGAGACAAGATACTGAAC
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa31821
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000102548 | Nonsense | 188 | 414 | 4 | 9 |
- Genomic Location (Zv9):
- Chromosome 11 (position 13695423)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 13452246 GRCz11 11 13509905 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGGGAGACCGAGACAAGATACTGAACAATCAAACAACTTATTCCACCTA[T/A]TTTAGACCATCAGATGACAACAGGTGATAATATTGTAATTCTGTATGCAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: