wu:fc28f08

Ensembl ID:
ENSDARG00000070059
ZFIN ID:
ZDB-GENE-030131-3152

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35051 Nonsense Mutation detected in F1 DNA During 2018
sa14951 Nonsense Available for shipment Available now
sa8736 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35051
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102518 Nonsense 15 485 1 3
Genomic Location (Zv9):
Chromosome 11 (position 14553433)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 14254729
GRCz11 11 14312388
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGTTATGAATTCAATAAGTTTTAAATACCTGCGTCGTGAATGTGTATA[T/A]TCTCGGTATTGCTGTGTCCCGTTTTGTAAAATTTCATCAAGGTTTAATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14951
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102518 Nonsense 179 485 1 3
Genomic Location (Zv9):
Chromosome 11 (position 14553924)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 14255220
GRCz11 11 14312879
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCCTGAAGAGAAAGGTTGCAGAGTTTTCTGTCAATCAGAGATTTTGTT[T/A]GGGRCGATTTGCAGCATCTGAYGATGACATAAGGTTTTAYACTAGGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8736
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102518 Nonsense 329 485 3 3
Genomic Location (Zv9):
Chromosome 11 (position 14559472)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 14260768
GRCz11 11 14318427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCAGACACACAAGTGATAATTGACTGTATAGAGCTTTGTTGYCGAATA[C/T]AATCATCTGACCTGTTCCCAGATGAAGGGTACGATTGCACCTTCAAGGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link