Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
wu:fc28f08
- Ensembl ID:
- ENSDARG00000070059
- ZFIN ID:
- ZDB-GENE-030131-3152
Alleles
There are 3 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa35051 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa14951 | Nonsense | Available for shipment | Available now |
| sa8736 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa35051
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000102518 | Nonsense | 15 | 485 | 1 | 3 |
- Genomic Location (Zv9):
- Chromosome 11 (position 14553433)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 14254729 GRCz11 11 14312388 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATAGTTATGAATTCAATAAGTTTTAAATACCTGCGTCGTGAATGTGTATA[T/A]TCTCGGTATTGCTGTGTCCCGTTTTGTAAAATTTCATCAAGGTTTAATTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14951
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000102518 | Nonsense | 179 | 485 | 1 | 3 |
- Genomic Location (Zv9):
- Chromosome 11 (position 14553924)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 14255220 GRCz11 11 14312879 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGTCCTGAAGAGAAAGGTTGCAGAGTTTTCTGTCAATCAGAGATTTTGTT[T/A]GGGRCGATTTGCAGCATCTGAYGATGACATAAGGTTTTAYACTAGGTAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa8736
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000102518 | Nonsense | 329 | 485 | 3 | 3 |
- Genomic Location (Zv9):
- Chromosome 11 (position 14559472)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 14260768 GRCz11 11 14318427 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACCCAGACACACAAGTGATAATTGACTGTATAGAGCTTTGTTGYCGAATA[C/T]AATCATCTGACCTGTTCCCAGATGAAGGGTACGATTGCACCTTCAAGGGG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
