
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-30j22.9
- Ensembl ID:
- ENSDARG00000070052
- ZFIN ID:
- ZDB-GENE-041001-210
- Description:
- Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5RHL8]
- Human Orthologue:
- TDRD6
- Human Description:
- tudor domain containing 6 [Source:HGNC Symbol;Acc:21339]
- Mouse Orthologue:
- Tdrd6
- Mouse Description:
- tudor domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2679727]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa9787 | Nonsense | Available for shipment | Available now |
sa43494 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa3060 | Nonsense | F2 line generated | During 2018 |
sa23764 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa9787
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000102504 | Nonsense | 266 | 1281 | 1 | 3 |
ENSDART00000124497 | Nonsense | 281 | 1623 | 1 | 2 |
ENSDART00000141627 | None | 337 | None | 8 |
- Genomic Location (Zv9):
- Chromosome 20 (position 35470906)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 35543419 GRCz11 20 35446298 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAGGTTTTCTCTCAGGAGCTGAAAAAGTTGACTGAACAGATCACTCAGTA[T/G]TACGAGGGAAGAGTAGGAAGYTATTTTGCAAGAGCTGAGARTTTGGGCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43494
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000102504 | Nonsense | 281 | 1281 | 1 | 3 |
ENSDART00000124497 | Nonsense | 296 | 1623 | 1 | 2 |
ENSDART00000141627 | None | 337 | None | 8 |
- Genomic Location (Zv9):
- Chromosome 20 (position 35470950)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 35543463 GRCz11 20 35446342 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCAGTATTACGAGGGAAGAGTAGGAAGCTATTTTGCAAGAGCTGAGAATT[T/A]GGGCAGCCCATGTGCATCAAGAGGAAGTGATGGCAAATGGTATCGTTCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa3060
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000102504 | Nonsense | 380 | 1281 | 1 | 3 |
ENSDART00000124497 | Nonsense | 395 | 1623 | 1 | 2 |
ENSDART00000141627 | None | 337 | None | 8 |
- Genomic Location (Zv9):
- Chromosome 20 (position 35471246)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 35543759 GRCz11 20 35446638 - KASP Assay ID:
- 554-2708.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACCTGAAATCTCTGTTGCTCAATCGCACAGTGATTGCCAAGTTTCAGTAT[C/T]AAAGCCTTTCTGAGGGTGTCCACTATGTAACACTTTATGGAGAGGAGAAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23764
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000102504 | Nonsense | 546 | 1281 | 2 | 3 |
ENSDART00000124497 | Nonsense | 567 | 1623 | 2 | 2 |
ENSDART00000141627 | None | 337 | None | 8 |
- Genomic Location (Zv9):
- Chromosome 20 (position 35471792)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 35544305 GRCz11 20 35447184 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTACTTCCTCGACTATGGCAACACAGAAGTTGTTGATAGTTTTAACCTT[C/T]GACAGCTGCCTTTAAGATTCCAGCAGCTACCAGCTGTGGCAGTAAAATGC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: