si:dkey-30j22.9

Ensembl ID:
ENSDARG00000070052
ZFIN ID:
ZDB-GENE-041001-210
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5RHL8]
Human Orthologue:
TDRD6
Human Description:
tudor domain containing 6 [Source:HGNC Symbol;Acc:21339]
Mouse Orthologue:
Tdrd6
Mouse Description:
tudor domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2679727]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9787 Nonsense Available for shipment Available now
sa43494 Nonsense Mutation detected in F1 DNA During 2018
sa3060 Nonsense F2 line generated During 2018
sa23764 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9787
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102504 Nonsense 266 1281 1 3
ENSDART00000124497 Nonsense 281 1623 1 2
ENSDART00000141627   None 337 None 8
Genomic Location (Zv9):
Chromosome 20 (position 35470906)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35543419
GRCz11 20 35446298
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGTTTTCTCTCAGGAGCTGAAAAAGTTGACTGAACAGATCACTCAGTA[T/G]TACGAGGGAAGAGTAGGAAGYTATTTTGCAAGAGCTGAGARTTTGGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43494
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102504 Nonsense 281 1281 1 3
ENSDART00000124497 Nonsense 296 1623 1 2
ENSDART00000141627   None 337 None 8
Genomic Location (Zv9):
Chromosome 20 (position 35470950)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35543463
GRCz11 20 35446342
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGTATTACGAGGGAAGAGTAGGAAGCTATTTTGCAAGAGCTGAGAATT[T/A]GGGCAGCCCATGTGCATCAAGAGGAAGTGATGGCAAATGGTATCGTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3060
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102504 Nonsense 380 1281 1 3
ENSDART00000124497 Nonsense 395 1623 1 2
ENSDART00000141627   None 337 None 8
Genomic Location (Zv9):
Chromosome 20 (position 35471246)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35543759
GRCz11 20 35446638
KASP Assay ID:
554-2708.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTGAAATCTCTGTTGCTCAATCGCACAGTGATTGCCAAGTTTCAGTAT[C/T]AAAGCCTTTCTGAGGGTGTCCACTATGTAACACTTTATGGAGAGGAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23764
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102504 Nonsense 546 1281 2 3
ENSDART00000124497 Nonsense 567 1623 2 2
ENSDART00000141627   None 337 None 8
Genomic Location (Zv9):
Chromosome 20 (position 35471792)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35544305
GRCz11 20 35447184
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTACTTCCTCGACTATGGCAACACAGAAGTTGTTGATAGTTTTAACCTT[C/T]GACAGCTGCCTTTAAGATTCCAGCAGCTACCAGCTGTGGCAGTAAAATGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link