zgc:153920

Ensembl ID:
ENSDARG00000070041
ZFIN ID:
ZDB-GENE-061013-702
Description:
hypothetical protein LOC768181 [Source:RefSeq peptide;Acc:NP_001070792]
Human Orthologue:
C10orf81
Human Description:
chromosome 10 open reading frame 81 [Source:HGNC Symbol;Acc:26285]
Mouse Orthologue:
9930023K05Rik
Mouse Description:
RIKEN cDNA 9930023K05 gene Gene [Source:MGI Symbol;Acc:MGI:2443041]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16458 Essential Splice Site Available for shipment Available now
sa35319 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16458
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102464 Essential Splice Site 8 287 1 9
Genomic Location (Zv9):
Chromosome 12 (position 32204632)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30425609
GRCz11 12 30540511
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCTATTTYAGCAAWAAGGCAACAACATGAGCAACARAACTAAATCAGG[T/C]AAGCCTAAAATATATTTGAGACACGGGNTAANTGAAGGAAAGCGATGAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35319
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102464 Nonsense 249 287 8 9
Genomic Location (Zv9):
Chromosome 12 (position 32200624)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30421601
GRCz11 12 30536503
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACAGCATATAACTCTTTCTGACAGAGGTTTCTGAGCGATATCAAGGAC[G/T]AGAGGGTCGAAGAGGAGGATGAATCTCCAGAGGAAGCCACTGAATACATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link